Nu ai cum să subestimezi rolul ADN-ului în ceea ce privește viața de pe Pământ. E imposibil. Pot să-i fac icoană și statuie în Piața Universității și tot nu îmi poți reproșa “Alex, exagerezi”. Primul om care a reușit să sintetizeze ADN a fost Friedrich Miescher, care prin 1869 a descoperit această moleculă compusă din hidrogen, oxigen, azot și (în mod dubios) fosfor. Apoi, prin 1953, James Watson și Francis Crick (având bafta unei contribuții extrem de importante din partea lui Rosalind Franklin) au descoperit structura moleculei de ADN. De atunci și până acum, în doar 63 de ani am reușit să descifrăm cât de cât secretele ADN-ului și chiar să facem o hartă a codului genetic uman.

[Featured image de Sophia Foster-Dimino]

Mesaje moleculare

ADN-ul (acidul dezoxiribonucleic) este o moleculă gigant în formă de dublu helix care este compusă din patru baze azotate: adenină (A), guanină (G), citozină (C) și timină (T). Bazele astea sunt fix niște molecule mai mici compuse din azot, hidrogen și oxigen. Pe marginea moleculei se găsesc două helixuri (sau catene) de zahăr fosfat, care sunt practic coloana vertebrală a ADN-ului.

large
Trei reprezentări ale moleculei de ADN.

Molecula de ADN este extraordinar de importantă pentru că ea deține informația vieții. Absolut toată informația despre tine, de la domeniul, regnul și specia din care faci parte și până la culoarea ochilor și cât de păros ești este inclusă în ADN-ul fiecărei celule din corpul tău. Dar cum este scrisă informația asta? Cum arată instrucțiunile? Asta este partea cea mai fascinantă.

Dacă te uiți la un calculator, o să îți dai seama că el lucrează în sistemul binar, adică toate informațiile pe care le primește sunt în unu (1) și zero (0). În funcție de ordinea pe care o au aceste două cifre într-o secvență, se pot întâmpla diverse chestii. De exemplu codul 01100001 (litera a) e diferit de 01000001 (litera A).

ADN-ul nostru (deci și noi și pisicile noastre) funcționează la fel, doar că se află în baza 4, pentru că are patru caractere ce pot fi combinate: cele patru baze azotate, adenina, guanina, citozina și timina, care sunt molecule. La fel cum literele din această postare sunt așezate una după cealaltă astfel încât să îți “dea instrucțiuni” despre cum să înțelegi toate conceptele astea, așa și cele patru baze azotate sunt ordonate una după cealaltă:

dna_labeled
O scurtă secvență din molecula de ADN.

GAGTCTGGCAACTGTTGATA scrie pe rândul de sus. Pentru tine și mine nu înseamnă mare chestie, dar pentru celulele noastre sunt niște instrucțiuni clare. Ce ai mai sus este o porțiune de ADN. Atunci când citim instrucțiunile din ADN, citim bazele azotate (A,T,C,G) și un alt lucru important e că instrucțiunile provin doar de la câte trei baze azotate. Astfel, un set de trei baze azotate produc aminoacizi, care la rândul lor se adună și creează proteine. Proteinele creează celule, celulele creează țesuturi, țesuturile creează organe și în cele din urmă (dacă le pui corect), organele te formează pe tine.

Probabil te întrebi de ce în imaginea de mai sus este notat doar un rând. De lene? Nu neapărat. Vezi tu, cele patru baze azotate se pot combina doar în anumite feluri: adenina se poate combina doar cu timina (A+T sau T+A), iar citozina doar cu guanina (C+G sau C+G). Oriunde s-ar afla o bază A în ADN, ea se va combina mereu doar cu T. De aceea, poți alege o singură catenă (latură) a ADN-ului pe care să o reprezinți, pentru că de acolo poți să afli și din ce e compusă cealaltă catenă.

De exemplu, pe baza secvenței notate pe catena de sus din imaginea de deasupra, ne putem da seama că pe catena de jos secvența de baze azotate e: CTCAGACCGTTGACAACTAT. IMPORTANT e că ordinea contează: A+T nu este același lucru cu T+A.  Adică dacă ai pe catena (latura) de ADN  de deasupra un T și pe cealaltă un A, nu e aceeași chestie cu un A pe catena de deasupra și un T pe catena de dedesubt. Înțelegi?

După cum vezi, bazele astea azotate au o anumită formă și fiecare dintre ele se potrivește doar cu o altă singură bază azotată.
După cum vezi, bazele astea azotate au o anumită formă și fiecare dintre ele se potrivește doar cu o altă singură bază azotată. ©3DMolecularDesigns

De exemplu, dacă ADN-ul are instrucțiunea CAA, înseamnă că celula trebuie să producă Acid Glutamic. Dacă apare AGT, atunci se creează Serină. În total sunt 64 de combinații posibile de câte trei baze azotate și 20 de aminoacizi. Dar 64 minus 20 dă 44. Ce se întâmplă cu celelalte 44 de combinații de baze azotate? Alea la ce folosesc? Unele coduri sunt pentru același aminoacid.

De exemplu, codurile TTT și TTC sunt ambele pentru Lizină.  De asemenea, unele dintre coduri au rol diferit. Ele acționează ca semnale de pornire și de oprire, pentru a arăta unde se termină și unde începe altă genă. Acest lucru spune ribozomului din celulă (am vorbit în postarea trecută, Celula: atomul biologic, despre ribozomi) de unde să înceapă cititul și unde să se oprească când substanța necesară este complet produsă.

 Vine Moș Ene pe la gene

Genele sunt instrucțiunile oferite de bazele azotate, dar însumate și strânse la un loc. O singură latură de ADN poate avea mii de gene, iar acele gene pot fi mai lungi (cu peste un milion de baze azotate) sau mai scurte (cu vreo trei sute de baze azotate). Cu cât o genă este mai lungă, cu atât are mai multe instrucțiuni pentru crearea unei proteine mai mari.

În funcție de forma și mărimea proteinei este determinat rolul acesteia în corpul viu. Hemoglobina (care ajută la preluarea oxigenului din plămâni în sânge și plimbarea acestuia prin corp) și Pepsina (proteină digestivă care descompune moleculele mari din sistemul digestive, pentru a fi absorbite de organism) sunt astfel de proteine.

Genele sunt organizate în exoni, iar ele reprezintă doar 5% din ADN. Între ele sunt fâșii lungi de baze azotate aranjate aleatoriu și care nu conțin instrucțiuni. Aceste bucăți sunt numite introni. Mutațiile ADN-ului sunt foarte frecvente (apar ca urmare a copierii defectuoase a ADN-ului, în momentul diviziunii unei celule) și se întâmplă destul de des ca acestea să apară în materialul genetic, dar nu e panică. Asta pentru că în majoritatea cazurilor mutațiile se petrec în introni, care oricum sunt baze azotate puse la nimereală.

Însă uneori apar mutații și în exoni, unde se află codul genetic. Uneori, aceste mutații pot fi reparate de celule (după miliarde de ani petrecuți pe Pământ, viața a învățat o grămadă de șmecherii), dar alteori o genă este afectată atât de mult încât îi poate schimba modul de funcționare sau o poate opri cu totul.

Gene
O genă este formată din exoni și introni.

De exemplu, avem o secvență dintr-o genă: CTC, care are rolul de a produce hip-hop  un aminoacid. Brusc, intervine o mutație în acea genă și schimbă secvența din CTC în ATC. Din păcate, ATC este codul pentru stop. Astfel, gena nu va mai funcționa, fiindcă se va opri din fabricarea proteinei la jumătatea procesului.

Din cauza faptului că celulele se bazează pe gene pentru instrucțiuni, este important ca toate genele noastre să fie la locul lor cu toate bazele azotate în ordinea corectă. Dacă o genă lipsește sau este deteriorată, s-ar putea să nu putem produce o substanță de care corpul nostru are nevoie.

Vezi? Când ribozomul vede bazele azotate ATG, știe că trebuie să înceapă să producă aminoacizi pentru proteine. Când vede TGA, știe că trebuie să se oprească.
Vezi? Când ribozomul vede bazele azotate ATG, știe că trebuie să înceapă să producă aminoacizi pentru proteine. Când vede TGA, știe că trebuie să se oprească.

De exemplu, oamenii care nu pot produce factorul 8 coagulator de sânge. Genele pentru acest factor sunt deteriorate, care duc la imposibilitatea sângelui de a se coagula. Astfel, chiar și cele mai mici tăieturi refuză să se închidă, aceasta fiind boala numită hemofilie. Ce mai e important e că numărul de gene dintr-un organism nu indică neapărat complexitatea acestuia.

De exemplu, noi oamenii avem cam 20.251 de gene, în timp ce un pește balon are cam 22.000-29.000 de gene. ADN-ul nu numai că este unic pentru fiecare specie în parte, ci și pentru orice individ al oricărei specii de animale sau vegetale: nu numai că eu am ADN-ul diferit decât cel al unui câine, dar e și diferit față de al tău.

La om, ADN-ul conține cam 3,27 miliarde de perechi de baze (o bază azotată pe o catenă, o bază azotată pe cealaltă catenă, asta e perechea), adică e foarte foarte lung! Dacă am scrie toată secvența ADN de baze azotate de la om, am scrie vreo 4000 de cărți a câte 500 de pagini. 4000 de cărți pline de AAGTGGATGCGCCGTAG…blabla.

 Pierdut în translație

Să zicem că ești un puertorican care vrea să facă niște sarmale d-astea românești, pardon, dacice. Ai găsit rețeta, dar e în română. Tu nu înțelegi limba română, vrei neapărat sarmale, dar nu se găsește nicăieri rețeta tradusă. Așa că îl rogi pe amicul tău Manolito  să o noteze pe o foaie de hârtie și să o traducă în limba spaniolă, cu caracterele specifice alfabetului limbii spaniole. În fine, el traduce rețeta, tu te apuci să faci sarmalele, totu-i bine. Familia te felicită pentru felul de mâncare extraordinar, iubita tăbară pe tine, orașul te proclamă erou și aia e. Ești un fel de zeu.

©Khan Academy
©Khan Academy

Acuma, imaginează-ți că rețeta aia în limba română este o secvență de ADN (șirul ăla de baze azotate de care am vorbit mai sus). Nucleul unei celule face o copie a unei porțiuni de ADN (asta fiind faza de transcriere) care devine mARN (ARN mesager). mARN-ul este doar un șir de baze azotate care este trimis la ribozomii din celulă, adică un șir de instrucțiuni de pe o singură latură de ADN. Ribozomii care citesc instrucțiunile din mARN (traduse pe limba lor) și se apucă să fabrice polipeptide, aminoacizi care sunt fie o parte din, fie o proteină întreagă (astea fiind produsul finit, adică sarmalele). Asta este faza de translație.

După cum observi, am introdus un nou termen în toată chestia asta: mARN. Există mai multe tipuri de ARN, dar mARN este cel mai relevant pentru ce vorbim aici, d-aia am vorbit doar despre el. ARN-ul (acidul ribonucleic) este tot o macromoleculă ca ADN-ul și este aproape similară, dar sunt câteva diferențe:

  • Are o singură catenă, adică o singură latură;
  • Are bazele azotate guanină, adenină, citozină, dar NU are timină. În locul ei folosește uracilul (U);
  • Nu are ca structură de zahăr dezoxiriboza, ci riboza.
ARN vs. ADN ©TesTeach
ARN vs. ADN
©TesTeach

Diferența dintre ele e că ADN-ul menține și deține informația pentru crearea de proteine, în timp ce ARN-ul folosește acea informație pentru a permite celulei să creeze proteine. Dacă ribozomii nu primesc mARN, nu fac nimic. E ca atunci când te roagă părinții să te duci până la magazin să cumperi ceva, dar ești foarte foarte uituc. Așa că ei (ADN-ul) îți scriu pe un bilețel (mARN-ul) ce trebuie să cumperi (proteinele).

 Ce-i mult strică

Am vorbit mai sus despre cum genele sunt niște secțiuni din molecula de ADN, niște instrucțiuni, mai exact. Molecula de ADN nu stă dezlânată (dacă ar sta așa, o singură moleculă ar avea 1,5-3 metri lungime), ci stă încolăcită într-o structură pe care o numim cromozom.

Eu și tu avem în fiecare nucleu al celulelor noastre 23 de perechi de cromozomi (adică 46 de cromozomi). 22 din perechile astea se numesc autozomi și se găsesc atât în femei, cât și în bărbați. Firește, instrucțiunile din ei diferă, dar ideea e că fie că ești bărbat sau femeie, ai clar perechile astea de cromozomi (presupunând că ești om normal, fără defecte genetice).

Cromozomii corpului uman.
Cromozomii corpului uman. Tipul ăsta de imagine cu cromozomii aliniați unul după celălalt se numește cariotip.

Dar mai e o pereche de doi cromozomi, care este mai specială: cromozomii de sex (li se mai spune și heterozomi în română sau allosomes în engleză). După cum le spune și numele, ei au rolul de a determina sexul unei persoane și sunt de două feluri: cromozomi X și cromozomi Y. Dacă ai cromozomii XX, atunci ești femeie. Dacă ai cromozomii XY, ești bărbat.

Dar uite că și la nivelul ăsta apar defecte care nu pot fi reparate la fel de ușor ca cele ce țin de “liniile de cod” ale ADN-ului. Astfel, avem anomalii precum hermafroditism, în care persoana are ambele perechi de heterozomi: și XX și XY. Sau avem cazuri în care un bărbat are heterozomii XXY, afecțiune care se numește sindromul Klinefelter. Bărbații care au încă un cromozom X pe lângă perechea XY pot avea puțin păr, sâni măriți și un bazin mai larg. În aproape toți cei afectați, testiculele rămân mici, iar penisul nu ajunge la dimensiunile unui adult. De obicei nu pot face copii, dar pot avea o viață sexuală normală. După cum vezi, ce-i mult strică atunci când vine vorba de cromozomi și coduri genetice.

 Reparații și mentenanță

Problema cu bolile genetice e că țin de gene, adică se întâmplă la un nivel microscopic, aproape la nivelul atomilor, așa că normal că avem mult mai mult de furcă cu ele decât cu un virus sau o bacterie. Mai ales că bolile genetice pot apărea încă dinainte să te naști. Din câte știm până acum, sunt peste 6000 de boli genetice care pot fi date mai departe de la părinți la copii. Anual se nasc mii de copii cu aceste boli cauzate de diverse mutații din codul lor genetic și până recent am stat și ne-am uitat neputincioși la ce se întâmplă.

Un prim pas spre remedierea acestor situații ar fi cunoașterea codului nostru genetic. Ohooo! Ai crede că e ușor dar nu e. În 1990 am pornit în această odisee numită Proiectul Genomului Uman, la care au participat țări precum SUA, Regatul Unit al Marii Britanii, Japonia, Franța, Germania, Canada și China. Scopul a fost să determinăm toate secvențele bazelor azotate care compun ADN-ul uman și de a întocmi un soi de hartă al lor.

Firește, nu există om care să aibă toate bazele azotate în aceeași ordine, același cod genetic, dar cercetătorii au făcut o medie a ADN-urilor (un soi de medie aritmetică, să zic așa). În anul 2003 Proiectul Genomului Uman a fost declarat ca fiind complet. Este o realizare incredibilă a speciei umane și este unul din lucrurile pe care trebuie neapărat să le știi în viața asta. Oamenii care au lucrat la proiectul ăsta sunt niște eroi.

Practic, acum știm exact ce ne face oameni și  cu ce suntem diferiți față de alte animale (de exemplu, față de cal, pentru că și harta genomului său a fost terminată în 2007). Ai mai jos un timeline al acestei descoperiri monumentale, care se întinde pe o perioadă de (DOAR) 13 ani:

humangenome

Foarte recent am început în sfârșit să ne jucăm și noi cu ADN-ul și cu codul genetic prin intermediul a ce se numește CRISPR. Suntem încă la început, asta e clar, și încă ne întrebăm cum să conectăm piesele astea de Lego. Unii oameni se tem, făcându-și griji și tot felul de scenarii apocaliptice, întrebându-se dacă nu cumva n-ar fi mai bine să ne oprim aici.

Părerea mea este că ar trebui să continuăm cu tehnologia și vedem pe parcurs ce se întâmplă. Cum să înveți să mergi pe bicicletă și să ajungi mai repede la muncă, dacă tu nici nu vrei să te sui pe ea? O să greșim, clar, dar o să învățăm din asta. Cum să înveți să mergi pe bicicletă dacă nu cazi și nu te sui iar pe ea? În doar 13 ani am reușit să aflăm exact care este setul de instrucțiuni care ne face să fim oameni. În fiecare an, doar în SUA, se nasc mii de copii cu grave afecțiuni pe fond genetic. Cu toată puterea asta pe care o deținem, pentru prima oară în istoria vieții de pe Pământ, oare ne putem permite să nu ne “jucăm” cu propriul ADN și să salvăm mii de vieți?

“Cu toate slăbiciunile noastre, în pofida limitelor şi defectelor noastre, noi, oamenii, suntem capabili de măreție.” –Carl Sagan, Un Palid Punct Albastru